View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13049_low_25 (Length: 254)
Name: NF13049_low_25
Description: NF13049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13049_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 12 - 237
Target Start/End: Complemental strand, 40655789 - 40655565
Alignment:
| Q |
12 |
aagaacttaattgtaacaattaaaaattaagagattaaattcaggcaaaaacttattgaacggtcaaagccacaacattgaccagcaactaagccttgan |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40655789 |
aagaacttaattgtaacaattaaaaattaaaagattaaattcaggcaaaaacttattgaacggtcaaagccacaacattgaccagcaactaagccttgat |
40655690 |
T |
 |
| Q |
112 |
nnnnnnaggtttatacgcaactctcttttttaactctgaattctggatttcaagaaaattggataaatgaaaattagttaacatctattattcttatatt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40655689 |
ttttt-aggtttatacgcaactctcttttttaactctgaattctggatttcaagaaaattggataaatgaaaattagttaacatctattattcttatatt |
40655591 |
T |
 |
| Q |
212 |
tctagtgaataatcaaaacaagattt |
237 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
40655590 |
tctagtgaataatcaaaacaagattt |
40655565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University