View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13049_low_30 (Length: 245)
Name: NF13049_low_30
Description: NF13049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13049_low_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 32453810 - 32453882
Alignment:
| Q |
1 |
tcatgttcttcatttatcttgttcttcatttcattataatatgcataaagctcattaatatcaatccagaaag |
73 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
32453810 |
tcatgtttttcatttatcttgttcttcatttcattataatatgcataaagctcattaatatcaacctagaaag |
32453882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 176 - 228
Target Start/End: Original strand, 32453986 - 32454038
Alignment:
| Q |
176 |
atcaccacatctttcaatttttcacattaatcttcaattcatttgtttcactc |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32453986 |
atcaccacatctttcaatttttcacattaatcttcaattcatttgtttcactc |
32454038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University