View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13049_low_34 (Length: 206)
Name: NF13049_low_34
Description: NF13049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13049_low_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 12 - 188
Target Start/End: Complemental strand, 28272730 - 28272554
Alignment:
| Q |
12 |
atcatcatcacctaattttttcgtgaaagaaaatagtgttgtcttcttccaaaccaatgatctgtgagaaagaaatttgagaaacttatttaaattatat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28272730 |
atcatcatcacctaattttttcgtgaaagaaaatagtgttgtcttcttccaaaccaatgatctgtgagaaagaaatttgagaaacttatttaaattatat |
28272631 |
T |
 |
| Q |
112 |
taaatgtcgaaaagtattctaagaaaacattcagataacacaccatatcagcataatgtcgttttgctgactgccct |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28272630 |
taaatgtcgaaaagtattctaagaaaacattcagataacacaccatatcagcataatgtcgttttgctgactgccct |
28272554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University