View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13049_low_9 (Length: 429)
Name: NF13049_low_9
Description: NF13049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13049_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 31 - 339
Target Start/End: Original strand, 21137194 - 21137501
Alignment:
| Q |
31 |
tcttcgaaacttttcgtgggtctgcttacctgtttgtcaaatttgtttaatcaa-tagtcttgatagttgaggttcattgatagttgtattgtggtttac |
129 |
Q |
| |
|
||||| ||||||||| ||| ||||||||||||| ||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21137194 |
tcttcaaaacttttcatggatctgcttacctgtgtgtcaaatttgtttaattaaatagtcttgatagttgaggttcattgatagttgtattgtggtttac |
21137293 |
T |
|
| Q |
130 |
ctgttataataaacatctcaatgcaagaaacattcatttagtaaatgagtattcctcggaaaagtcataggatgcggtatgagtcaaacaagctgcgatt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| ||||||||| | |||| |
|
|
| T |
21137294 |
atgttataataaacatctcaatgcaagaaacattcatttagtaaatgtgtattccttggaaaagtcataggatgcggtatgagccaaacaagccgtgatt |
21137393 |
T |
|
| Q |
230 |
tctcttgcggttattgatgtctacctaagccataccagggaagaactttctttcctttctttgtccagattcatataaatctaacatccttttagttctg |
329 |
Q |
| |
|
||||||||| || |||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
21137394 |
tctcttgcgattgttgatgtctaactaagccataccagggaagaacttcctttcctttctttgtccagattc--ataaatctagcatccttttagttctg |
21137491 |
T |
|
| Q |
330 |
gaccatattt |
339 |
Q |
| |
|
|||||||||| |
|
|
| T |
21137492 |
gaccatattt |
21137501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 358 - 404
Target Start/End: Original strand, 21137502 - 21137548
Alignment:
| Q |
358 |
tatcctaagcaatattcttgatatgatttatcggttaaatgttgagc |
404 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
21137502 |
tatcctaaacaatattcttaatatgatttatcgattaaatgttgagc |
21137548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 198 - 246
Target Start/End: Complemental strand, 23434120 - 23434072
Alignment:
| Q |
198 |
aggatgcggtatgagtcaaacaagctgcgatttctcttgcggttattga |
246 |
Q |
| |
|
||||||||||||||| ||||||||| || ||||||||||||||||||| |
|
|
| T |
23434120 |
aggatgcggtatgagccaaacaagcaacgctttctcttgcggttattga |
23434072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University