View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1304_high_108 (Length: 254)

Name: NF1304_high_108
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1304_high_108
NF1304_high_108
[»] chr5 (2 HSPs)
chr5 (1-83)||(37244409-37244491)
chr5 (41-85)||(37305157-37305201)


Alignment Details
Target: chr5 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 37244491 - 37244409
Alignment:
1 tgtattctcagtgattcgggatggccatgggtcaagaaaatttatgattttcttgtttaacgactcacgatgatcttcctgta 83  Q
    |||||||| | |||||||||||||||||||||||||||| |||||||||||||  ||||||||||||||||||||||||||||    
37244491 tgtattcttaatgattcgggatggccatgggtcaagaaattttatgattttctcctttaacgactcacgatgatcttcctgta 37244409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 37305201 - 37305157
Alignment:
41 tttatgattttcttgtttaacgactcacgatgatcttcctgtaat 85  Q
    ||||||||||||| || |||| ||||| |||||||||||||||||    
37305201 tttatgattttctcgtctaacaactcatgatgatcttcctgtaat 37305157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University