View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1304_high_109 (Length: 254)
Name: NF1304_high_109
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1304_high_109 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 204 - 246
Target Start/End: Complemental strand, 16841342 - 16841300
Alignment:
| Q |
204 |
aaaaaggaccccatttagagcaacttactccgtttctctctct |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
16841342 |
aaaaaggaccccatttagagcaacttactccgattctctctct |
16841300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 204 - 243
Target Start/End: Original strand, 37698490 - 37698529
Alignment:
| Q |
204 |
aaaaaggaccccatttagagcaacttactccgtttctctc |
243 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
37698490 |
aaaaaggaccccatttagagcaacttacaccgattctctc |
37698529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 204 - 242
Target Start/End: Original strand, 37437398 - 37437436
Alignment:
| Q |
204 |
aaaaaggaccccatttagagcaacttactccgtttctct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
37437398 |
aaaaaggaccccatttagagcaacttacaccgattctct |
37437436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University