View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1304_high_109 (Length: 254)

Name: NF1304_high_109
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1304_high_109
NF1304_high_109
[»] chr4 (1 HSPs)
chr4 (204-246)||(16841300-16841342)
[»] chr5 (2 HSPs)
chr5 (204-243)||(37698490-37698529)
chr5 (204-242)||(37437398-37437436)


Alignment Details
Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 204 - 246
Target Start/End: Complemental strand, 16841342 - 16841300
Alignment:
204 aaaaaggaccccatttagagcaacttactccgtttctctctct 246  Q
    |||||||||||||||||||||||||||||||| ||||||||||    
16841342 aaaaaggaccccatttagagcaacttactccgattctctctct 16841300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 204 - 243
Target Start/End: Original strand, 37698490 - 37698529
Alignment:
204 aaaaaggaccccatttagagcaacttactccgtttctctc 243  Q
    |||||||||||||||||||||||||||| ||| |||||||    
37698490 aaaaaggaccccatttagagcaacttacaccgattctctc 37698529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 204 - 242
Target Start/End: Original strand, 37437398 - 37437436
Alignment:
204 aaaaaggaccccatttagagcaacttactccgtttctct 242  Q
    |||||||||||||||||||||||||||| ||| ||||||    
37437398 aaaaaggaccccatttagagcaacttacaccgattctct 37437436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University