View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1304_high_122 (Length: 249)
Name: NF1304_high_122
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1304_high_122 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 28 - 249
Target Start/End: Complemental strand, 49003437 - 49003212
Alignment:
| Q |
28 |
aaattttcaaccataatggtttacgtatttaatgagggtggtcgtgctttcctaaactttccttatatatccccaatactct--atacatatagaaacta |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
49003437 |
aaattttcaaccataatggtttacgtatttaatgagggtggtcgtgctttcctaaactttccttatatatccccaatactctctatacatatagaaacta |
49003338 |
T |
 |
| Q |
126 |
ctactagtcaacaacaaaggaac--aaagagctcattatattgaaaaggagtaaaaatgggtaatgcttgctttggaaagaagatgagcaacaagggagt |
223 |
Q |
| |
|
|| |||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49003337 |
cttctagtcaacaacaaaggaactgaaagagctcattatattgcaaaggagtaaaaatgggtaatgcttgctttggaaagaagatgagcaacaagggagt |
49003238 |
T |
 |
| Q |
224 |
ggtgcaccccgtggtagttcaccgca |
249 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
49003237 |
ggtgcaccccgtggtagttcaccgca |
49003212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University