View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1304_high_132 (Length: 215)
Name: NF1304_high_132
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1304_high_132 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 28267834 - 28267954
Alignment:
| Q |
1 |
attatttcttgcaatccaaaaatgaaattaaatcctctggctcaggtccgcttccttgctttatcagcaacaattccaaatattgaggatctaggtattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28267834 |
attatttcttgcaatccaaaaatgaaattaaatcctctggctcaggtccgcttcctcgctttatcagcaacaattccaaatattgaggatctaggtattt |
28267933 |
T |
 |
| Q |
101 |
tctttttcacttgatgatgtc |
121 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
28267934 |
tctttttcacttgatgttgtc |
28267954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University