View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1304_high_133 (Length: 214)
Name: NF1304_high_133
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1304_high_133 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 47 - 173
Target Start/End: Original strand, 33115921 - 33116048
Alignment:
| Q |
47 |
gttgtcaatcaatagtttgttcaaatccgctacaaaa-cagtgttttagcgatgctacaaccactatgtgacagaattttgcttgtctctacagggtaaa |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |||| |||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33115921 |
gttgtcaatcaatagtttgttcaaatccgctacaaaaacagtgtcttagggatgctacaatcattatgtgacagaattttgcttgtctctacagggtaaa |
33116020 |
T |
 |
| Q |
146 |
gaggaggaaggaaaagcaattctgagaa |
173 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
33116021 |
gaggaggaaggaaaagcaattctgagaa |
33116048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University