View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1304_high_141 (Length: 201)

Name: NF1304_high_141
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1304_high_141
NF1304_high_141
[»] chr7 (2 HSPs)
chr7 (71-123)||(28450092-28450144)
chr7 (1-48)||(28450161-28450208)


Alignment Details
Target: chr7 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 71 - 123
Target Start/End: Complemental strand, 28450144 - 28450092
Alignment:
71 ctacacaagaaagtaccttaaatttaagcaacttgattagaacagatattatt 123  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
28450144 ctacacaagaaagtaccttaaatttaagcaacttgattagaacagatattatt 28450092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 28450208 - 28450161
Alignment:
1 ggatgtcctgtccttgaggatttcaaggcatgccatgtattcacgtta 48  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
28450208 ggatgtcctgtccttgaggatttcaaggcatgccatgtattcacgtta 28450161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University