View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1304_high_84 (Length: 320)

Name: NF1304_high_84
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1304_high_84
NF1304_high_84
[»] chr3 (2 HSPs)
chr3 (109-169)||(49510486-49510546)
chr3 (122-169)||(49521436-49521483)


Alignment Details
Target: chr3 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 109 - 169
Target Start/End: Complemental strand, 49510546 - 49510486
Alignment:
109 aagttttgttggtggtattgatctttgtgatgggagatatgataccatggaacatcctttg 169  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49510546 aagttttgttggtggtattgatctttgtgatgggagatatgataccatggaacatcctttg 49510486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 122 - 169
Target Start/End: Complemental strand, 49521483 - 49521436
Alignment:
122 ggtattgatctttgtgatgggagatatgataccatggaacatcctttg 169  Q
    |||||||||||||| ||||| ||||||||||| |||||||||||||||    
49521483 ggtattgatctttgcgatggaagatatgatacaatggaacatcctttg 49521436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University