View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1304_high_89 (Length: 309)
Name: NF1304_high_89
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1304_high_89 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 277; Significance: 1e-155; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 1 - 285
Target Start/End: Original strand, 3881025 - 3881309
Alignment:
| Q |
1 |
ccgattcatgatttgaatctcgatctgaaagctaagcaactcccttttttcatctacttctcagcttgctcttcgatctctcaatttaggaatatgccca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3881025 |
ccgattcatgatttgaatctcgatctgaaagctaagcaactcccttttttcatctacttctcagcttgctcttcgatctctcaatttaggaatatgccca |
3881124 |
T |
 |
| Q |
101 |
aaattaaacatactccgcattgaagcaacgttaatggtctccattgagttgaaaggatgtgacggactgtctgaagcatcccttaattgtcctctcttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3881125 |
aaattaaacatactccgcattgaagcaacgttaatggtctccattgagttgaaaggatgtgacggactgtctgaagcatcccttaattgtcctctcttga |
3881224 |
T |
 |
| Q |
201 |
catctctggatgcttccttttgcaggtgatgctttatttgctagtttcttggttatcttgcttgcgtatggagtatggactgatg |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
3881225 |
catctctggatgcttccttttgcaggtgatgctttatttgctagtttcttggctatcctgcttgcgtatggagtatggactgatg |
3881309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 3 - 284
Target Start/End: Original strand, 3867271 - 3867552
Alignment:
| Q |
3 |
gattcatgatttgaatctcgatctgaaagctaagcaactcccttttttcatctacttctcagcttgctcttcgatctctcaatttaggaatatgcccaaa |
102 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||| || ||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3867271 |
gattcatgatttgaatctcaatctgatagctaagcaacttccgtttttcatctacttctcaggttggtcttcgatctctcaatttaggaatatgcccaaa |
3867370 |
T |
 |
| Q |
103 |
attaaacatactccgcattgaagcaacgttaatggtctccattgagttgaaaggatgtgacggactgtctgaagcatcccttaattgtcctctcttgaca |
202 |
Q |
| |
|
|||||||||||| ||||||||||| | |||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3867371 |
attaaacatacttcgcattgaagcgatgttaatggtctcacttgagttgaaaggatgtggtggactgtctgaagcatcccttaattgtcctctcttgaca |
3867470 |
T |
 |
| Q |
203 |
tctctggatgcttccttttgcaggtgatgctttatttgctagtttcttggttatcttgcttgcgtatggagtatggactgat |
284 |
Q |
| |
|
|| |||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||| |||||||||||| |||||| |
|
|
| T |
3867471 |
tcactggatgcttccttttgcaggtgacgctttatctgctagtttcttggttatcctgcttatgtatggagtatgtactgat |
3867552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University