View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1304_high_93 (Length: 295)
Name: NF1304_high_93
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1304_high_93 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 41 - 125
Target Start/End: Complemental strand, 41858590 - 41858506
Alignment:
| Q |
41 |
ggcgaaggatactcaaacaatagggnnnnnnntacaataacataaaactgaaacactgaaacttaaacaatggggaaaggatttt |
125 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41858590 |
ggcgaaggatactcaaacaatagggaaaaaaatacaataacataaaactgaaacactgaaacttaaacaatggggaaagcatttt |
41858506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University