View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1304_low_118 (Length: 275)
Name: NF1304_low_118
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1304_low_118 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 261
Target Start/End: Complemental strand, 46914646 - 46914386
Alignment:
| Q |
1 |
agacacagcaacaacaaacacaaggacaataaacgaactctgtttgtcacccacgatctctaccaacaacatcaaacaataaattccaagaaattacagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46914646 |
agacacagcaacaacaaacacaaggacaataaacgaactctgtttgtcacccacgatctctaccaacaacatcaaacaataaattccaagaaattacagc |
46914547 |
T |
|
| Q |
101 |
ataccttttattttctttcacaaaaagatnnnnnnnncctagagattagtactatgataactgaaaacaaacaaaactatttaatctctgcaattatnnn |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
46914546 |
atactttttattttctttcacaaaaagataaaaaaaacctagagattagtactatgataactgaaaacaaacaaaactatttaaactctgcaattataaa |
46914447 |
T |
|
| Q |
201 |
nnnnncaaaacaacattgaaacaccaaaatgtccttctccaacccccaccaacacaccccc |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46914446 |
aaaaacaaaacaacattgaaacaccaaaatgtccttctccaacccccaccaacacaccccc |
46914386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University