View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1304_low_126 (Length: 256)
Name: NF1304_low_126
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1304_low_126 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 18 - 219
Target Start/End: Complemental strand, 30586642 - 30586441
Alignment:
| Q |
18 |
tgaatggatgtaatcattggatacactctccaaatcgacggagatcgagacaaacttcaaattgagcgtcagcggcatcatcttcaaataagaacactgc |
117 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30586642 |
tgaatggatgtaatcattggatacgctctccaaatcgacggagatcgagacaaacttcaaattgagcgtcagcggcatcatcttcaaataagagcactgc |
30586543 |
T |
 |
| Q |
118 |
gcttagtggcagcgaatggggtgtatcatgtcttggtggggaagcacgtttgaaaggtttacggtgaagaaaccagggtaaaaagcttctttcccttctc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30586542 |
gcttagtggcagcgaatggggtgtatcaggtctcggtggggaagcacgttcgaaaggtttacggtgaagaaaccagggtaaaaagcttctttcccttctc |
30586443 |
T |
 |
| Q |
218 |
tg |
219 |
Q |
| |
|
|| |
|
|
| T |
30586442 |
tg |
30586441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University