View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1304_low_127 (Length: 255)
Name: NF1304_low_127
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1304_low_127 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 7 - 95
Target Start/End: Complemental strand, 19841071 - 19840983
Alignment:
| Q |
7 |
ggaacatttatcatgtcatcatgaattaagattaattccaagttgatgaagaactccaagagcatggaaaatagacaaactaaacaaat |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
19841071 |
ggaacatttatcatgtcatcatgaattaagattaattccaagttgatgaagaactctaagagcatggaaaatagacaaactaaacaaat |
19840983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University