View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1304_low_128 (Length: 254)
Name: NF1304_low_128
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1304_low_128 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 37244491 - 37244409
Alignment:
| Q |
1 |
tgtattctcagtgattcgggatggccatgggtcaagaaaatttatgattttcttgtttaacgactcacgatgatcttcctgta |
83 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37244491 |
tgtattcttaatgattcgggatggccatgggtcaagaaattttatgattttctcctttaacgactcacgatgatcttcctgta |
37244409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 37305201 - 37305157
Alignment:
| Q |
41 |
tttatgattttcttgtttaacgactcacgatgatcttcctgtaat |
85 |
Q |
| |
|
||||||||||||| || |||| ||||| ||||||||||||||||| |
|
|
| T |
37305201 |
tttatgattttctcgtctaacaactcatgatgatcttcctgtaat |
37305157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University