View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1304_low_132 (Length: 252)
Name: NF1304_low_132
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1304_low_132 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 13 - 158
Target Start/End: Original strand, 38072383 - 38072536
Alignment:
| Q |
13 |
aatatgagtagaagagagagcaaatttagataaatgatgagtcacaatattggtacatgtaattatatgagtaaacaaaaaggaatgaatacggaaaata |
112 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38072383 |
aatatgagtaaaagagagagcaaatttagataaatgatgagtcataatattggtacatgtaattatatgactaaacaaaaaggaatgaatacggaaaata |
38072482 |
T |
|
| Q |
113 |
tgatgccaatagtca--------ctcacttcagtaggtttgattacttgtaaga |
158 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
38072483 |
tgatgccaatagtcaccaagcacctcacttcagtaggtttgattacttggaaga |
38072536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University