View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1304_low_133 (Length: 252)
Name: NF1304_low_133
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1304_low_133 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 28 - 252
Target Start/End: Original strand, 40187805 - 40188029
Alignment:
| Q |
28 |
catgaccaataaatattgagagggacttgttgcatccactatacaagaatgtggtctctgccttctccattttttggtgaaacacacaggtcnnnnnnng |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40187805 |
catgaccaataaatattgagagggacttgttgcatccactatacaagaatgtggtctctgccttctccattttttggtgaaacacacaggtctttttttg |
40187904 |
T |
|
| Q |
128 |
gatgacaacaactattttccaatagggttttcaattatttattatcatacaaaagagtgtgataagtgagaacacactcttaacacaaaagcnnnnnnnn |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40187905 |
gatgacaacaactattttccaatagggttttcaattatttattatcatacaaaagagtgtgataagtgagaacacactcttaacacaaaagcaaaaaaaa |
40188004 |
T |
|
| Q |
228 |
gggaatgaaaggagcgtagaataaa |
252 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
40188005 |
gggaatgaaaggagcgtagaataaa |
40188029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University