View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1304_low_138 (Length: 251)
Name: NF1304_low_138
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1304_low_138 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 16 - 226
Target Start/End: Original strand, 3331085 - 3331295
Alignment:
| Q |
16 |
atgcaataatgaaacaacataaaatgaagacgttaccttgaatccagaaacataaaatgtagtgtctcacatgctaaagcaagcctgattatggctgatc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3331085 |
atgcaataatgaaacaacataaaatgaagacgttaccttgaatccagaaacataaaatgtagtgtctcacaggctaaagcaagcctgattatggctgatc |
3331184 |
T |
 |
| Q |
116 |
atgcagatcaaatgcccatacatatgatcaagaaataattaacatgcaaaaatgagttttcaaacacttcgtcaagtgaatgcatgaaggcacaacaact |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3331185 |
atgcagatcaaatgcccatacatatgatcaagaaataattaacatgcaaaaatgagttttcaaacacttcatcaagtgaatgcatgaaggcacaacaact |
3331284 |
T |
 |
| Q |
216 |
tgctattattc |
226 |
Q |
| |
|
||||||||||| |
|
|
| T |
3331285 |
tgctattattc |
3331295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University