View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1304_low_144 (Length: 250)
Name: NF1304_low_144
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1304_low_144 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 12 - 250
Target Start/End: Complemental strand, 53480963 - 53480725
Alignment:
| Q |
12 |
gaaccaaatttggaaaagacattgctcccattcataatagacatgctgtagaaccttgttggaaaagacattgctcacattcaaccatctcaagtcagag |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53480963 |
gaaccaaatttggaaaagacattgctcccattcataatagacatgttgtagaaccttgttggaaaagacattgctcacattcaaccatctcaagtcagag |
53480864 |
T |
 |
| Q |
112 |
aacctccaaacaccaaaaatcgggcagtnnnnnnncggattgttgttttctctttgccagaattaactacgtccagacatctaggatgtaatgttacgcc |
211 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||||||||||||| |||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
53480863 |
aacctccaaacaccaaaaatcggatagtaaaaaaacggattgttgttttctctttgccataattaactacgtcctgacatctaggatgtgatgttacgct |
53480764 |
T |
 |
| Q |
212 |
catcattaaaaaacatttgataaacacctttagtaggtt |
250 |
Q |
| |
|
|| ||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
53480763 |
caccattagaaaacatttgataaacacctttaataggtt |
53480725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University