View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1304_low_153 (Length: 231)
Name: NF1304_low_153
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1304_low_153 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 76 - 214
Target Start/End: Original strand, 11902865 - 11903003
Alignment:
| Q |
76 |
aatgttactgatgataatgttgcagaatcaattggttgtattttataaattacaatcttcatggttagttataattataatcttcaactcaataccacat |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11902865 |
aatgttactgatgataatgttgcagaatcaattggttgtattttataaattacaatcttcatggttagttataattataatcttcaactcaataccacat |
11902964 |
T |
|
| Q |
176 |
ataaagatttaaataaaggaatgtgatcgcgatataggc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11902965 |
ataaagatttaaataaaggaatgtgatcgcgatataggc |
11903003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University