View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1304_low_166 (Length: 205)
Name: NF1304_low_166
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1304_low_166 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 71 - 123
Target Start/End: Complemental strand, 28450144 - 28450092
Alignment:
| Q |
71 |
ctacacaagaaagtaccttaaatttaagcaacttgattagaacagatattatt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28450144 |
ctacacaagaaagtaccttaaatttaagcaacttgattagaacagatattatt |
28450092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 28450208 - 28450161
Alignment:
| Q |
1 |
ggatgtcctgtccttgaggatttcaaggcatgccatgtattcacgtta |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28450208 |
ggatgtcctgtccttgaggatttcaaggcatgccatgtattcacgtta |
28450161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University