View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1304_low_24 (Length: 534)
Name: NF1304_low_24
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1304_low_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 136 - 420
Target Start/End: Complemental strand, 15096989 - 15096702
Alignment:
| Q |
136 |
atgaacatggttgtattgatggcggggtatgtcggcttgtttaggaagaaggagatgatgttaaagtggcccggctg---cggcggtggcggagggatga |
232 |
Q |
| |
|
||||||||||| || |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| || || |||||||||||||||||||| |
|
|
| T |
15096989 |
atgaacatggtcgtgttgatggcggggtatgtcgggttgtttaggaagaaggagatgatgttaaaatggccgggttgtggcggcggtggcggagggatga |
15096890 |
T |
 |
| Q |
233 |
tggttgtgagtgaaggtttgggggagttgatgaaattggctgtacctagttgtcttatgatatgtttggaatggtggtggtatgagattgttactgtttt |
332 |
Q |
| |
|
|||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15096889 |
tggtggttagtgaaggtttgggggagttgatgaaattggctgtacctagttgtcttatgatatgtttggaatggtggtggtatgagattgttactgtttt |
15096790 |
T |
 |
| Q |
333 |
ggctggttatttggagaatcctacattggctgttgctgctactgggattttgattcagacaactagtatgatgtatactgtccctatg |
420 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15096789 |
ggctggttatttggagaatcctacattggctgttgctgctactgggattttgattcagacaactagtatgatgtatactgtccctatg |
15096702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University