View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1304_low_47 (Length: 460)
Name: NF1304_low_47
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1304_low_47 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 8e-65; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 8e-65
Query Start/End: Original strand, 171 - 320
Target Start/End: Complemental strand, 34020058 - 34019909
Alignment:
| Q |
171 |
ttgtatagtggacgactcaatcaacgatcataatgcctcagtcttgataaacttttttcttgaaagagaagcttgttagatgatatttttgtttaaggta |
270 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34020058 |
ttgtgtagtggacgactcaatgaacgatcataatacctcagtcttaataaacttttttcttgaaagagaagcttgttagatgatatttttgtttaaggta |
34019959 |
T |
|
| Q |
271 |
tgttttgtcagttattgtgtagtcattatcatatgtaatgtgatatatta |
320 |
Q |
| |
|
||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34019958 |
tgtattgtccgttattgtgtagtcattatcatatgtaatgtgatatatta |
34019909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 59 - 133
Target Start/End: Complemental strand, 34020158 - 34020084
Alignment:
| Q |
59 |
aactttatgctttgcattttatttttgattccagactgtccccaagttgtgtcacacgtactctcctatgatatc |
133 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34020158 |
aactttatgcttttgattttatttttgattccaaactgtccccaagttgtgtcacacgtactctcctaggatatc |
34020084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 17 - 78
Target Start/End: Complemental strand, 34020232 - 34020171
Alignment:
| Q |
17 |
tgctagtactagtacattaatattattcaataattgctggttaactttatgctttgcatttt |
78 |
Q |
| |
|
||||| ||||| ||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34020232 |
tgctattactaatacattagtattattcaataattgctggttaactttatgctttggatttt |
34020171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University