View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1304_low_61 (Length: 403)
Name: NF1304_low_61
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1304_low_61 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 1e-88; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 41 - 210
Target Start/End: Complemental strand, 25294111 - 25293942
Alignment:
| Q |
41 |
tgtgcgtggaacaaggttaccgtagaggccgagaatgacgcgaccgagtaaggtggattcggagcatagggtggagatggtgtcgccgagggtgcgattt |
140 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25294111 |
tgtgcgtggaacgaggttaccgtagaggccgagaatgacgcgaccgagtaaggtggattcggagcatagggtggagatggtgtcgccgagggtgcgattt |
25294012 |
T |
 |
| Q |
141 |
gggaggtaatagttggggcagaggctgaagtccatgaagatgcggtcggtgatggtggggtttggtagct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25294011 |
gggaggtaatagttggggcagaggctgaagtccatgaagatgcggtcggtgatggtggggtttggtagct |
25293942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 297 - 392
Target Start/End: Complemental strand, 25293855 - 25293760
Alignment:
| Q |
297 |
ttgagaattgggtggtggagagaggggagtagtggtggttgttgggttatggaggaagccattgaggagaggagagtagtgagttaggttgttcat |
392 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25293855 |
ttgagaattgggtggtggagagaggggagtggtggtggttgttgggttatggaggaagccattgaggagaggagagtagtgagttaggttgttcat |
25293760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University