View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1304_low_63 (Length: 395)
Name: NF1304_low_63
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1304_low_63 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 30 - 386
Target Start/End: Original strand, 14333778 - 14334146
Alignment:
| Q |
30 |
ctcaggataaaaaatttgtgtgtgaagaagctgatagggcacttggatcaatggtggaatccatgacacctcttccattgcttcagaaactaaggttatc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14333778 |
ctcaggataaaaaatttgtgtgtgaagaagctgatagggcacttggatcaatggtggaatccatgacacctcttccattgcttcagaaactaaggttatc |
14333877 |
T |
|
| Q |
130 |
tgtgagtcacaaaaaccttaggatcagggctaaagctgctgtttctctatccaaatgtgtctccaaaatggtaaagtttgccactccatttgaattatga |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14333878 |
tgtgagtcacaaaaaccttaggatcagggctaaagctgctgtttctctatccaaatgtgtctccaaaatggtaaagtttggtactccatttgaattatga |
14333977 |
T |
|
| Q |
230 |
tatgatgtagtgttattt------------attttgatacatggtctaggtagaaagttttatactgtcaacaaatcacaaccaattaacgatccgatgg |
317 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14333978 |
tatgatgtagtgttatttattttgagtttaattttgatacatggtctaggtagaaagttttatactgtcaacaaatcacaaccaattaacgatccgatgg |
14334077 |
T |
|
| Q |
318 |
tgtatatgaattaaatcaatttgttttattggtgtttttgggtttgtgtatgtttctaaagagtattat |
386 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14334078 |
tgtatatgaattatatcaatttgttttattggtgtttttgggtttatgtatgtttctaaagagtattat |
14334146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University