View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1304_low_71 (Length: 374)
Name: NF1304_low_71
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1304_low_71 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 3e-70; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 195 - 345
Target Start/End: Original strand, 6316795 - 6316945
Alignment:
| Q |
195 |
tttaatccctatttaactatacttgccggccatcattttatcatgtcatgttgagaagctcgcttgaacttctttggttgaaggtaccgagtattcttag |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6316795 |
tttaatccctatttaactatacttgccggccatcattttatcatgtcatgttgagaagctcacttgaacttctttggttgaaggtaccgggtattcttag |
6316894 |
T |
 |
| Q |
295 |
gacacaaacaatactttgtatcttcaggtgtcggtgctggaaagatgcaat |
345 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6316895 |
gacacaaacaatactttgtatcttcagacgtcggtgctggaaagatgcaat |
6316945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 245 - 345
Target Start/End: Original strand, 6326109 - 6326209
Alignment:
| Q |
245 |
ttgagaagctcgcttgaacttctttggttgaaggtaccgagtattcttaggacacaaacaatactttgtatcttcaggtgtcggtgctggaaagatgcaa |
344 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6326109 |
ttgagaagctcacttgaacttctttggttgaaggtaccgagtattcttaggacacaaacaatactttgtatcttcaggtgtcggtgctggaaagatgcaa |
6326208 |
T |
 |
| Q |
345 |
t |
345 |
Q |
| |
|
| |
|
|
| T |
6326209 |
t |
6326209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 126 - 207
Target Start/End: Original strand, 6326029 - 6326110
Alignment:
| Q |
126 |
catgtcctttgtttagtttttcagacacccaccagattatatgtccaacctgttgataaaaatacaaaatttaatccctatt |
207 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6326029 |
catgtcctttgtttagttttgcagacacccaccagattatatctccaacctgttgataaaaatacaaaatttaatccctatt |
6326110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 241 - 345
Target Start/End: Original strand, 6306905 - 6307009
Alignment:
| Q |
241 |
catgttgagaagctcgcttgaacttctttggttgaaggtaccgagtattcttaggacacaaacaatactttgtatcttcaggtgtcggtgctggaaagat |
340 |
Q |
| |
|
|||||||| |||||| ||||||||| ||||| ||||||||| || ||||||||||| ||||||||||| ||||||||| | || |||| ||||||||| |
|
|
| T |
6306905 |
catgttgaaaagctcatttgaacttcattggtggaaggtaccaaggattcttaggactcaaacaatactctgtatcttccgatgatggtgttggaaagat |
6307004 |
T |
 |
| Q |
341 |
gcaat |
345 |
Q |
| |
|
||||| |
|
|
| T |
6307005 |
gcaat |
6307009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University