View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1304_low_77 (Length: 355)
Name: NF1304_low_77
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1304_low_77 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 16 - 177
Target Start/End: Complemental strand, 3903143 - 3902981
Alignment:
| Q |
16 |
atcacctctaacctcaaccctatcatcctaaatcgcttttacaaaccttgtgggacttaattgaagatgtcgacaacctacatcttgaaatatttgtgga |
115 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3903143 |
atcacctctaacctcaaccctatcgtcctaaatcgcttttacaaaccttgtgggacttaattgaagatgtccacaacctacatcttgaaatatttgtgga |
3903044 |
T |
 |
| Q |
116 |
gacttgcttttttggcctcccaaaaatactaa-attgttccgttcataactatcgaacgacaa |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3903043 |
gacttgcttttttggcctcccaaaaatactaatattgttccgttcataactatcgaacgacaa |
3902981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 225 - 355
Target Start/End: Complemental strand, 3902964 - 3902834
Alignment:
| Q |
225 |
ccagcataactagaaaaacaaagctcatatttgtgagcttttgtccatctatggtctatggtctccctccttgggctggatagtgctacaactaatacct |
324 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3902964 |
ccagcataactagaaaaacacagctcatatttgtgagcttttgttcatctatggtctatggtctccctccttgggctggatagtgctacaactaatacct |
3902865 |
T |
 |
| Q |
325 |
ctgcattctcacaccaacctcaccccctatg |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3902864 |
ctgcattctcacaccaacctcaccccctatg |
3902834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University