View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1304_low_82 (Length: 337)
Name: NF1304_low_82
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1304_low_82 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 52 - 329
Target Start/End: Complemental strand, 36934286 - 36934009
Alignment:
| Q |
52 |
ctaatgatcttcacttctgctgagtattgttttacaccctgccttgaatctgctgaaatcctcttgatagctgcaactgagttcgagtctttaaaatagc |
151 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36934286 |
ctaatgatcttcacttctgcggagtattgttttacaccctgccttgaatctgctgaaatcctcttgatagctgcaactgagttcgagtctttaaaatagc |
36934187 |
T |
 |
| Q |
152 |
ccttataaacaccgccaaaaccaccttggccaagcttctgtgtctcttcaaagttgtttgttgcattcaacaattcataataactaatcttctttggtcc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36934186 |
ccttataaacaccgccaaaaccaccttggcctagcttctgtgtctcttcaaagttgtttgttgcattcaacaattcataataactaatcttctttggtcc |
36934087 |
T |
 |
| Q |
252 |
agcacccatttggaattcatcatccatatcctgatcagaagtggtttctgaagtaggttcatcttcttttcctttgtt |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36934086 |
agcacccatttggaattcatcatccatatcctgatcagaagtggtttctgaagtaggttcatcttcttttcctttgtt |
36934009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 5e-19; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 138 - 278
Target Start/End: Complemental strand, 47871323 - 47871183
Alignment:
| Q |
138 |
gtctttaaaatagcccttataaacaccgccaaaaccaccttggccaagcttctgtgtctcttcaaagttgtttgttgcattcaacaattcataataacta |
237 |
Q |
| |
|
|||||| |||||||| ||||||||||| |||||||||||||| || | ||| ||||| ||||||||||| || |||||| | | ||||| || ||| | | |
|
|
| T |
47871323 |
gtctttcaaatagcctttataaacaccaccaaaaccaccttgtcctatcttttgtgtttcttcaaagttattggttgcacttaccaatttattatagcaa |
47871224 |
T |
 |
| Q |
238 |
atcttctttggtccagcacccatttggaattcatcatccat |
278 |
Q |
| |
|
| ||| || ||||||| ||| ||||||||||||||||||| |
|
|
| T |
47871223 |
aactttttaggtccagttcccttttggaattcatcatccat |
47871183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 139 - 278
Target Start/End: Original strand, 47874223 - 47874362
Alignment:
| Q |
139 |
tctttaaaatagcccttataaacaccgccaaaaccaccttggccaagcttctgtgtctcttcaaagttgtttgttgcattcaacaattcataataactaa |
238 |
Q |
| |
|
||||| |||||||| ||||||||||| |||||||||||||| || | ||| | || ||| ||||||| ||||||||| ||| ||||| | ||| | || |
|
|
| T |
47874223 |
tctttcaaatagcctttataaacaccaccaaaaccaccttgccctatcttttctgcttctgcaaagttatttgttgcactcaccaatttgttatagcaaa |
47874322 |
T |
 |
| Q |
239 |
tcttctttggtccagcacccatttggaattcatcatccat |
278 |
Q |
| |
|
||| || ||||||| ||| ||||||||||||||||||| |
|
|
| T |
47874323 |
actttttaggtccagtgcccttttggaattcatcatccat |
47874362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University