View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1304_low_95 (Length: 320)
Name: NF1304_low_95
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1304_low_95 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 109 - 169
Target Start/End: Complemental strand, 49510546 - 49510486
Alignment:
| Q |
109 |
aagttttgttggtggtattgatctttgtgatgggagatatgataccatggaacatcctttg |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49510546 |
aagttttgttggtggtattgatctttgtgatgggagatatgataccatggaacatcctttg |
49510486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 122 - 169
Target Start/End: Complemental strand, 49521483 - 49521436
Alignment:
| Q |
122 |
ggtattgatctttgtgatgggagatatgataccatggaacatcctttg |
169 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||| ||||||||||||||| |
|
|
| T |
49521483 |
ggtattgatctttgcgatggaagatatgatacaatggaacatcctttg |
49521436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University