View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1304_low_97 (Length: 314)
Name: NF1304_low_97
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1304_low_97 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 272; Significance: 1e-152; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 28 - 307
Target Start/End: Original strand, 41858609 - 41858888
Alignment:
| Q |
28 |
attgtatcatttgtatacatgcacaattactgcacagtgatatgatgtcatgctttaccaagttttaacccttttcatctcaaatcagatcattattgtt |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41858609 |
attgtatcatttgtatacatgcacaattactgcacagtgatatgatgtcatgctttaccaagttttaccccttttcatctcaaatcagatcattattgtt |
41858708 |
T |
|
| Q |
128 |
tgactctttcagttttatgttattatcaaaatttggtaatttcccttttattttcttgttatattgttatccttggaatctatgagcgtgctcctttgta |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41858709 |
tgactctttcagttttatgttattatcaaaatttggtaatttcccttttattttcttgttatattgttatccttggaatctatgagcgtgctcctttgta |
41858808 |
T |
|
| Q |
228 |
agtctaggttcgtatcccacgagtaccaacaattcctgtgttggccgttgggccagtacctaagtatttagcctatgcta |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41858809 |
agtctaggttcgtatcccacgagtaccaacaattcctgtgttggccgttgggccagtacctaagtatttagcctctgcta |
41858888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 100 - 176
Target Start/End: Original strand, 41877721 - 41877803
Alignment:
| Q |
100 |
tttcatctcaaatcagatcattattgtttgactctt------tcagttttatgttattatcaaaatttggtaatttccctttt |
176 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| || |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41877721 |
tttcatctcaaatcagatcactattgtttgacttttattgtttcagttttatgttattctcaaaatttggtaatttccctttt |
41877803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University