View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13050_high_11 (Length: 259)
Name: NF13050_high_11
Description: NF13050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13050_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 19 - 247
Target Start/End: Original strand, 48408072 - 48408304
Alignment:
| Q |
19 |
ccacgctccaccgacttccggcttttaagatgaattttgatttataaatgcttctccaaacaaaactatgattatgttcaaaatttgaatcgagaaaatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
48408072 |
ccacgctccaccgacttccggcttttaagatgaattttgatttacaaatgcttctccaaacaaaattagaattatgttcaaaatttgaatcgagaaaatt |
48408171 |
T |
 |
| Q |
119 |
acacctcagatagtatctagctttatacattcttacgtcaagagttacacttctggagaccaaaaccatggtctatccagcctttcaataaaacaa---- |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48408172 |
acacctcagatagtatctagctttatacattcttacgtcaagagttacacttctggagaccaaaaccatggtctatccagcctttcaataaaacaaggag |
48408271 |
T |
 |
| Q |
215 |
tagtttcaaatttatgaatataatgcggaccta |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
48408272 |
tagtttcaaatttatgaatataatgcggaccta |
48408304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University