View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13050_high_13 (Length: 250)
Name: NF13050_high_13
Description: NF13050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13050_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 34289128 - 34288893
Alignment:
| Q |
1 |
catctatctatcttttgctttggctgccatgattccttttannnnnnngttgaaatatttgaaatttcaaagttaaaatgttactacttttaatgttata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34289128 |
catctatctatcttttgctttggctgccatgattccttttatttttttgttgaaatatttgaaatttcaaagttaaaatgttactacttttaatgttata |
34289029 |
T |
|
| Q |
101 |
atgttactactaggtggcccctatctcttcaaaaagagtaagagtactgtttattaaattctaaagccttaatcatatttagtcccttaatcttttatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34289028 |
atgttactactaggtggcccctatctcttcaaaaagagtaagagtactgtttattaaattctaaagccttaatcatatttcgtcccttaatcttttatga |
34288929 |
T |
|
| Q |
201 |
ttgccatgaagaggagaccatggaggccattatata |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
34288928 |
ttgccatgaagaggagaccatggaggccattatata |
34288893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University