View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13050_high_14 (Length: 240)
Name: NF13050_high_14
Description: NF13050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13050_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 41474929 - 41475156
Alignment:
| Q |
1 |
aattagttttattgtttgaatttccacgtgtcatgtgataattagtgtatagtatgtacaatactataagaactgcatatagatatgaatgaatatttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41474929 |
aattagttttattgtttgaatttccacgtgtcatgtgataattagtgtatagtatgtacaatactataagaactgcatatagatatgaatgaatatttgt |
41475028 |
T |
 |
| Q |
101 |
gtatccttagtgaagaagtacccaggtgaggtcacgtttatttcctccgcgttgcgcagaatttctcgtttacctgtaaaactcaacaa-----caaatc |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41475029 |
gtatccttagtgaagaagtacccaggtgagttcacgtttatttcctctgcgttgcgcagaatttctcgtttacctgtaaaactcaacaacaaatcaaatc |
41475128 |
T |
 |
| Q |
196 |
cttcaccaaattcaaaaaccctcttttt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
41475129 |
cttcaccaaattcaaaaaccctcttttt |
41475156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University