View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13050_high_16 (Length: 237)
Name: NF13050_high_16
Description: NF13050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13050_high_16 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 18 - 237
Target Start/End: Complemental strand, 34289377 - 34289153
Alignment:
| Q |
18 |
tgttatttagcataaaagaatatactaaaattctcaagaagggaggtatagtatagttta-----ccttgtgtttgaatcattcttcggatcttgcatga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34289377 |
tgttatttagcataaaagaatatactaaaattctcaagaagggaggtatagtatagtttagtttaccttgtgtttgaatcattcttcggatcttgcatga |
34289278 |
T |
|
| Q |
113 |
acaaagaaaactgaaaatatgaaagaggtggaggaagagagcaaaatattttcatttgtattgttaagagtgaagaagagctttttggttcagtttgtga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34289277 |
acaaagaaaactgaaaatatgaaagaggtggaggaagagagcaaaatattttcatttgtattgttaagagtgaagaagagctttttggttcagtttgtga |
34289178 |
T |
|
| Q |
213 |
cttggcaacgtgcttctatcctttt |
237 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
34289177 |
cttggcaacgtgcttctatcctttt |
34289153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University