View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13050_high_8 (Length: 314)
Name: NF13050_high_8
Description: NF13050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13050_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 97 - 161
Target Start/End: Complemental strand, 6019082 - 6019018
Alignment:
| Q |
97 |
aacttacttgcagaaaagatgattgcaggtgagtgaaactgcggaatgaagtaaacccagactac |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6019082 |
aacttacttgcagaaaagatgattgcaggtgagtgaaactgcggaatgaagtaaacccagactac |
6019018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 238 - 301
Target Start/End: Complemental strand, 6018936 - 6018873
Alignment:
| Q |
238 |
ttggtaccagattggacatttgagttctcttcccattttttcaagatcccccatttctgatttc |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6018936 |
ttggtaccagattggacatttgagttctcttcccattttttcaagatcccccatttctgatttc |
6018873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 238 - 293
Target Start/End: Complemental strand, 20944763 - 20944708
Alignment:
| Q |
238 |
ttggtaccagattggacatttgagttctcttcccattttttcaagatcccccattt |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||||| |||||| |
|
|
| T |
20944763 |
ttggtaccagattggacatttgagttctctgcccatgttttcaagatccaccattt |
20944708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 100 - 144
Target Start/End: Original strand, 38009650 - 38009694
Alignment:
| Q |
100 |
ttacttgcagaaaagatgattgcaggtgagtgaaactgcggaatg |
144 |
Q |
| |
|
||||||||||||||| ||||| | ||||||||||||||| ||||| |
|
|
| T |
38009650 |
ttacttgcagaaaagttgattccgggtgagtgaaactgcagaatg |
38009694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 242 - 274
Target Start/End: Original strand, 38009798 - 38009830
Alignment:
| Q |
242 |
taccagattggacatttgagttctcttcccatt |
274 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
38009798 |
taccagattggacatttgagttctctgcccatt |
38009830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University