View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13050_low_12 (Length: 252)
Name: NF13050_low_12
Description: NF13050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13050_low_12 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 140 - 252
Target Start/End: Original strand, 7296247 - 7296352
Alignment:
| Q |
140 |
gggtattatcttgttatagttttattaatgttacttgttggttgtgacttgtggtgttgagttggaacttttgagtgtgcttctcttaaggtctcaggtt |
239 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7296247 |
gggtattatcttgttatagttttagtaatgttacttgttggttgt-------ggtgttgacctggaacttttgagtgtgcttctctcaaggtctcaggtt |
7296339 |
T |
|
| Q |
240 |
ttattaatcattc |
252 |
Q |
| |
|
||||||||||||| |
|
|
| T |
7296340 |
ttattaatcattc |
7296352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 18 - 74
Target Start/End: Original strand, 7296125 - 7296181
Alignment:
| Q |
18 |
catgcaagtagtgtttgagtctgatagacgattcaccaaacatttcaatagaaactc |
74 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7296125 |
catgcaagtagtgtttgagtctgatagaggattcaccaaacatttcaatagaaactc |
7296181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University