View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13051_low_14 (Length: 306)
Name: NF13051_low_14
Description: NF13051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13051_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 3 - 286
Target Start/End: Original strand, 3705628 - 3705910
Alignment:
| Q |
3 |
actgataaaatattgagtttactatttgttgatcgtgaccagtgttagttctaaattgcgttctgcaattgctcttgcattgcatgtttggtattatagt |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3705628 |
actgataaaatattgagtttactatttgttgatcgtgaccagtgttagttctaaattgcattctgcaattgctcttgcattgcatgtttggtattatagt |
3705727 |
T |
 |
| Q |
103 |
gagtttgctaaaatcacggctgcgattttggaaaaactattcactgtgataccaaacatgtgcgcaagtgcaatggggaatgatcgacgatatannnnnn |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3705728 |
gagtttgctaaaatcacggctgcgattttggaaaaactattcactgtgataccaaacatgtgcgcaagtgcaatggggaatgatcgacgatata-ttttt |
3705826 |
T |
 |
| Q |
203 |
nnnaaagcaataaggaaaaaagttgtacctgcacatcttgagcattaacatcaagatgatcagcaataaggaaacggaagcgag |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3705827 |
tttaaagcaataaggaaaaaagttgtacctgcacatcttgagcattaacatcaagatgatcagcaataaggaaacggaagcgag |
3705910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 83 - 119
Target Start/End: Original strand, 44980051 - 44980087
Alignment:
| Q |
83 |
tgcatgtttggtattatagtgagtttgctaaaatcac |
119 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
44980051 |
tgcatgtttggaattatagtgagtttgataaaatcac |
44980087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University