View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13051_low_16 (Length: 264)
Name: NF13051_low_16
Description: NF13051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13051_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 19 - 252
Target Start/End: Complemental strand, 35773190 - 35772957
Alignment:
| Q |
19 |
catatgattaacaaaattatactataaagatcagaccattcaaaaaaggaacatagagaagatatgattagtgtcaatgttcaattatttattaaactta |
118 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35773190 |
catatgattaacagaattaaactataaagatcagaccattcaaaaaaggaacatagagaagatatgattagtgtcaatgttcaattatttattaaactta |
35773091 |
T |
|
| Q |
119 |
tggaacaaatgcacatgacatgcaaatatgtgttttgcatatacatacccttagggaattcttcttgttattatttggaggatgatcagaaggcagagga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35773090 |
tggaacaaatgcacatgacatgcaaatatgtgttttgcatatacatacccttagggaattcttcttgttattatttggaggatgatcagaaggcagagga |
35772991 |
T |
|
| Q |
219 |
ggagtttttgaagttgcattataagaatgatgat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35772990 |
ggagtttttgaagttgcattataagaatgatgat |
35772957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University