View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13052_high_19 (Length: 281)
Name: NF13052_high_19
Description: NF13052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13052_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 15 - 263
Target Start/End: Original strand, 46574464 - 46574713
Alignment:
| Q |
15 |
tcaattttagttgtgtatccccattttgtagtgtaagtttaccattagtttgttcttgcannnnnnncaaccctcattagtataattccttaaaaattta |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
46574464 |
tcaattttagttgtgtatccccattttgtagtgtaagtttaccattaatttgttcttgcatttttttcaaccctcattggtataattccttaaaaattta |
46574563 |
T |
 |
| Q |
115 |
aattgatgctaagttaactttgatacaaggttgagagcgggctaataagggc-tcaatcacattacttaaggtctgcgtaaaagaacaacgttgcttgat |
213 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46574564 |
aattgatgctaagttaaccttgatacaaggttgagagcgggctaataagggcgtcaatcgcattacttaaggtctgcgtaaaagaacaacgttgcttgat |
46574663 |
T |
 |
| Q |
214 |
cactgaaggatcatcattaatgccattgtaagaaaataacatgcagctcc |
263 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
46574664 |
cactgaaggatcatcgttaatgccattgtaagaaaataacatacagctcc |
46574713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University