View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13052_low_10 (Length: 391)
Name: NF13052_low_10
Description: NF13052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13052_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 361; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 361; E-Value: 0
Query Start/End: Original strand, 15 - 375
Target Start/End: Original strand, 2767064 - 2767424
Alignment:
| Q |
15 |
tcattgaacccgtaggtccgtggacttcagcatgattatttgttggcatggactcaacagaaggatttggaattgaggattttatggttggattatcagt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2767064 |
tcattgaacccgtaggtccgtggacttcagcatgattatttgttggcatggactcaacagaaggatttggaattgaggattttatggttggattatcagt |
2767163 |
T |
 |
| Q |
115 |
gatgtaaattttaaggccaagctcacctcttacacgagagaaaatcccgcgcttttccaacggatagtgcaagacaactgcatcagcttgagggacaaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2767164 |
gatgtaaattttaaggccaagctcacctcttacacgagagaaaatcccgcgcttttccaacggatagtgcaagacaactgcatcagcttgagggacaaaa |
2767263 |
T |
 |
| Q |
215 |
gaagtacctgtgaggctaactttaccaagaaatgaacttgagttagtagctttggaatgacaatggacataagcttcaagagtgagatagtgaagattgg |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2767264 |
gaagtacctgtgaggctaactttaccaagaaatgaacttgagttagtagctttggaatgacaatggacataagcttcaagagtgagatagtgaagattgg |
2767363 |
T |
 |
| Q |
315 |
aaggatctgatatgttgaagtagaagctctcattccaaacaggattaagatccttttcttt |
375 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2767364 |
aaggatctgatatgttgaagtagaagctctcattccaaacaggattaagatccttttcttt |
2767424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University