View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13053_high_5 (Length: 236)
Name: NF13053_high_5
Description: NF13053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13053_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 66 - 235
Target Start/End: Original strand, 43906349 - 43906518
Alignment:
| Q |
66 |
ttatattttgtcaaccattttgtattataggctgatgtatctttgaacattagtcattgggtaatggctactatgcttggtttgcccctaatagaagttt |
165 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| ||||||| |||||| |
|
|
| T |
43906349 |
ttatattttggcaaccattttgtattataggctgatgtatgtttgaacattagtcattggctaatggctactatgcttgatttgctcctaataaaagttt |
43906448 |
T |
 |
| Q |
166 |
ggtaataaaaaagagtaggtagggaaaatcatatgtatttattgnnnnnnnccgaaaatatatgtatttg |
235 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
43906449 |
agtaataaaaaagagtaggtagggaaaattatatgtatttattgtttttttccgaaaatatatgtatttg |
43906518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University