View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13053_low_5 (Length: 259)
Name: NF13053_low_5
Description: NF13053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13053_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 9222905 - 9223153
Alignment:
| Q |
1 |
cactaacgagaatgcaaaaatattgttgtagaaagctaaaaacaagacaattattgttgttgaatgagctgaaaataggagcagataccgtttttccttg |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9222905 |
cactaaccagaatgcaaaaatattgttgtagaaagctaaaaacaagacaattattgt---tgaatgagctgaaaataggagcagataccgtttttccttg |
9223001 |
T |
|
| Q |
101 |
gaaagcttggaagaatgagaggaaattgcacacacatctacattcatctgcaagtatctcagacaattcttgtatgtttttatttttgaaggcagaataa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9223002 |
gaaagcttggaagaatgagaggaaattgcacacacatctacattcatctgcaagtatctcagacaattcttgtatgtttttatttttgaaggcagaataa |
9223101 |
T |
|
| Q |
201 |
agtttcataactgcatctagggcttgatcattatcttctcccacaggttctg |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9223102 |
agtttcataactgcatctagggcttgatcattatcttctcccactggttctg |
9223153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University