View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13054_high_2 (Length: 387)
Name: NF13054_high_2
Description: NF13054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13054_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 21 - 231
Target Start/End: Complemental strand, 43226775 - 43226565
Alignment:
| Q |
21 |
tatcacacatcccaatttgtttattcatgctacttgttggatgagtgaggtgcggtctaaaaagcttagacgaggggcttggttaatttggcacgccgtc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43226775 |
tatcacacatcccaatttgtttattcatgctacttgttggatgagtgaggtgcggtctaaaaagcttagacgaggggcttggttaatttggcacgccgtc |
43226676 |
T |
 |
| Q |
121 |
gtgtgggtggtttagaagatgagaaatgatcgaattttcaatgagaaggtgtgtggagttgatgaaatggtggagcaagtcaaggtgattttgtggcatt |
220 |
Q |
| |
|
||||||||||||||||||||||||| |||||| || || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43226675 |
gtgtgggtggtttagaagatgagaattgatcgcatatttaatgagaaggtgtgtggagttgatgaaatggtggagcaagtcaaggtgattttgtggcatt |
43226576 |
T |
 |
| Q |
221 |
ggagcttgagt |
231 |
Q |
| |
|
||||||||||| |
|
|
| T |
43226575 |
ggagcttgagt |
43226565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 219 - 266
Target Start/End: Complemental strand, 43226505 - 43226458
Alignment:
| Q |
219 |
ttggagcttgagtggttggtttacagttgcggcatttggtggtggtgg |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43226505 |
ttggagcttgagtggttggtttacagttgcggcatttggtggtggtgg |
43226458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 324 - 370
Target Start/End: Complemental strand, 43226374 - 43226328
Alignment:
| Q |
324 |
ttttcctctgttttgcgcagagctgttattctctcaggaaacactgt |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43226374 |
ttttcctctgttttgcgcagagctgttattctctcataaaacactgt |
43226328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 54 - 133
Target Start/End: Original strand, 15623144 - 15623223
Alignment:
| Q |
54 |
ttgttggatgagtgaggtgcggtctaaaaagcttagacgaggggcttggttaatttggcacgccgtcgtgtgggtggttt |
133 |
Q |
| |
|
|||||||| || |||||| ||||||||||||||||||||||||| |||||||||||||| || ||| | |||||||||| |
|
|
| T |
15623144 |
ttgttggacaagggaggtgtggtctaaaaagcttagacgaggggcgtggttaatttggcatgcggtcatttgggtggttt |
15623223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 54 - 133
Target Start/End: Original strand, 15646933 - 15647012
Alignment:
| Q |
54 |
ttgttggatgagtgaggtgcggtctaaaaagcttagacgaggggcttggttaatttggcacgccgtcgtgtgggtggttt |
133 |
Q |
| |
|
|||||||| || |||||| ||||||||||||||||||||||||| |||||||||||||| || ||| | |||||||||| |
|
|
| T |
15646933 |
ttgttggacaagggaggtgtggtctaaaaagcttagacgaggggcgtggttaatttggcatgcggtcatttgggtggttt |
15647012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 135 - 209
Target Start/End: Original strand, 16256768 - 16256842
Alignment:
| Q |
135 |
gaagatgagaaatgatcgaattttcaatgagaaggtgtgtggagttgatgaaatggtggagcaagtcaaggtgat |
209 |
Q |
| |
|
|||||||||||||||| | |||| ||| | || || ||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
16256768 |
gaagatgagaaatgatagggtttttaataacaaagtttgtggggttgatgaaatggtggatcaagtcaaggtgat |
16256842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University