View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13055_high_31 (Length: 240)
Name: NF13055_high_31
Description: NF13055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13055_high_31 |
 |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 129
Target Start/End: Original strand, 29690398 - 29690526
Alignment:
| Q |
1 |
ccttaagaaagctcatcaaatactcaactcatcttcatactcttctcaagtggatattcaacttattttccagctacctatgctatcccttatgcaaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29690398 |
ccttaagaaagctcatcaaatactcaactcatcttcatactcttctcaagtggatattcaacttattttccagctacctatgctatcccttatgcaaact |
29690497 |
T |
 |
| Q |
101 |
tcaaggttcttatcatcatcagcaaaggg |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29690498 |
tcaaggttcttatcatcatcagcaaaggg |
29690526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 122 - 223
Target Start/End: Original strand, 29691000 - 29691101
Alignment:
| Q |
122 |
gcaaagggtatccagatatatgtgccaatcccaagaagaagaagtagattgtgctgtgtgtctctgcacaatgaaagaaagggaagagattagagtccta |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29691000 |
gcaaagggtatccagatatatgtgccaatcccaagaagaagaagtagattgtgctgtgtgtctctgcacaatgaaagaaagggaagagattagagtccta |
29691099 |
T |
 |
| Q |
222 |
aa |
223 |
Q |
| |
|
|| |
|
|
| T |
29691100 |
aa |
29691101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 160 - 217
Target Start/End: Original strand, 27651 - 27708
Alignment:
| Q |
160 |
aagaagtagattgtgctgtgtgtctctgcacaatgaaagaaagggaagagattagagt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
27651 |
aagaagtagattgtgctgtgtgtctctgcacgatgaaagaaaaggaagagattagagt |
27708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University