View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13055_low_28 (Length: 263)
Name: NF13055_low_28
Description: NF13055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13055_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 17 - 246
Target Start/End: Complemental strand, 15851466 - 15851238
Alignment:
| Q |
17 |
agttacttagtagcttaacttttttagaataagacactattgcttcatggaggaaaccacattgatgagtttataaattgcgacaaatttgttaacgatg |
116 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15851466 |
agttacttagtagcttaacttctttagaataagacactattgcttcatgtaggaaaccacattgatgagtttataaattgcgacaaatttgttaacgatg |
15851367 |
T |
 |
| Q |
117 |
gtggttaattgttattgcnnnnnnnaatgtcgtcggatcaaagaaaaatgggtctgaggttttctactcctaatgtctatatttttcttcgagtgttgct |
216 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15851366 |
gtggttaatcgttattgc-ttttttaatgtcgtcggatcaaagataaatgggtcctaggttttctactcctaatgtctatatttttcttcgagtgttgct |
15851268 |
T |
 |
| Q |
217 |
gatttcgttttctgctagcgttacttgtct |
246 |
Q |
| |
|
||||| |||||||||||||||| ||||||| |
|
|
| T |
15851267 |
gattttgttttctgctagcgttgcttgtct |
15851238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University