View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13057_high_8 (Length: 265)
Name: NF13057_high_8
Description: NF13057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13057_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 12 - 247
Target Start/End: Original strand, 44595344 - 44595579
Alignment:
| Q |
12 |
atgaaaaggatccgacggtgcaccttttgctacagccaacaatccaatggctcaaaatcccttgctccatcgtataaccaaaataataaccatatccatc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44595344 |
atgaaaaggatccgacggtgcaccttttgctacagccaacaatccaatggctcaaaatcccttgctccatcgtataaccaaaataataaccatttccatc |
44595443 |
T |
|
| Q |
112 |
taagcgcgtgatcttttttatcgtccatggaagannnnnnnnatttaatcaatgttattggtatttaccaaaaattaatcacaaactatatttatgaata |
211 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44595444 |
taagcgcgtgatcttttctatcatccatggaagattttttttatttaatcaatgttattggtatttaccaaaaattaatcacaaactatatttatgaata |
44595543 |
T |
|
| Q |
212 |
gtaaactagagaaaatagtaatttttatgagggata |
247 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44595544 |
gtaagctagagaaaatagtaatttttatgagggata |
44595579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University