View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13057_low_11 (Length: 235)
Name: NF13057_low_11
Description: NF13057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13057_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 19 - 216
Target Start/End: Complemental strand, 45224952 - 45224759
Alignment:
| Q |
19 |
gacctgagcaagtcatacaatacaacagtaccatgccaattgggagtctcatttagtttcagtcacaaaaccctaattaaccaatgaatcaggtaaagaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45224952 |
gacctgagcaagtcatacaatacaacagtaacatgccaattgggagtctcatttagtttcagtcacaaaaccctaa----ccaatgaatcaggtaaagaa |
45224857 |
T |
 |
| Q |
119 |
catgttggtttgaagagtggagacacgttctcattaaagaatgaatataatgctgatttgaatatattatttctttcatgcttctgcaacgtaactat |
216 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45224856 |
catgttggtttgaagagtggagacatgttctgattaaagaatgaatataatgctgatttgaatatattatttctttcatgcttctgcaacgtaactat |
45224759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University