View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13057_low_8 (Length: 265)

Name: NF13057_low_8
Description: NF13057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13057_low_8
NF13057_low_8
[»] chr7 (1 HSPs)
chr7 (12-247)||(44595344-44595579)


Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 12 - 247
Target Start/End: Original strand, 44595344 - 44595579
Alignment:
12 atgaaaaggatccgacggtgcaccttttgctacagccaacaatccaatggctcaaaatcccttgctccatcgtataaccaaaataataaccatatccatc 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
44595344 atgaaaaggatccgacggtgcaccttttgctacagccaacaatccaatggctcaaaatcccttgctccatcgtataaccaaaataataaccatttccatc 44595443  T
112 taagcgcgtgatcttttttatcgtccatggaagannnnnnnnatttaatcaatgttattggtatttaccaaaaattaatcacaaactatatttatgaata 211  Q
    ||||||||||||||||| |||| |||||||||||        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44595444 taagcgcgtgatcttttctatcatccatggaagattttttttatttaatcaatgttattggtatttaccaaaaattaatcacaaactatatttatgaata 44595543  T
212 gtaaactagagaaaatagtaatttttatgagggata 247  Q
    |||| |||||||||||||||||||||||||||||||    
44595544 gtaagctagagaaaatagtaatttttatgagggata 44595579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University